• Decrease font size
  • Return font size to normal
  • Increase font size
U.S. Department of Health and Human Services

Reference Standard Sequence Library (RSSL) for Seafood Identification

  • Print
  • Share
  • E-mail
-

Additional Information for   Brotula barbata

This detail page provides additional information about the selected specimen as well as a 5' barcode (ca. 655 bases) (FASTA format) for each specimen that can be copied for use in other applications. For some Shrimp species, there is also a reverse 3' barcode (ca. 475 bases). In addition there are photographs or links to photographs for some of the specimens.

Sample ID: FDA 133
Common Name: Bearded Brotula
FDA Market Name(s): Brotula or Cuskeel
Voucher Source: NMNH
Voucher Number: 395486
Metadata: Authenticated: yes; vouchered: yes
Alabama Deep Sea Fishing Rodeo
CO1 DNA Sequence (barcode, FASTA format)
5' Barcode (~655 bp):
>FDA 133|CFSAN14611|Brotula barbata|COI-5P
CCTTTATATAGTATTTGGTGCTTGGGCCGGGATGGTCGGCACTGCTTTAAGCCTGTTAATTCGGGCGGAGCTAAGTCAACCAGGGGCCCTCCTTGGAGACGACCAGATTTATAACGTCATTGTTACAGCACATGCTTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATCGGAGGCTTCGGGAACTGACTTATCCCTCTTATGATTGGAGCCCCAGACATGGCATTCCCCCGAATAAATAACATAAGCTTCTGGCTCTTACCTCCCTCATTCCTACTCCTATTGGCCTCATCAGGCGTTGAAGCCGGGGCCGGGACTGGCTGAACCGTCTACCCCCCTCTCGCCGGCAACTTAGCCCACGCAGGAGCATCTGTAGACCTCACCATTTTCTCCCTCCATCTAGCAGGTGTGTCCTCAATCCTGGGGGCCATCAACTTTATTACAACTATTATTAACATAAAACCTCCTGCCATCTCACAATACCAAACGCCCCTGTTCGTGTGGGCCGTCCTAATCACCGCAGTCCTCCTTCTCCTCTCCCTACCAGTACTTGCTGCAGGGATTACCATGCTTCTGACTGACCGAAACCTAAACACAACCTTCTTT
PHOTOS TEXT: Photograph
PHOTOL TEXT: Photograph
Photo Display (500 × 375 px):
Photographer: J. Deeds

679661  

-
-