• Decrease font size
  • Return font size to normal
  • Increase font size
U.S. Department of Health and Human Services

Reference Standard Sequence Library (RSSL) for Seafood Identification

  • Print
  • Share
  • E-mail
-

Additional Information for   Archosargus probatocephalus

This detail page provides additional information about the selected specimen as well as a 5' barcode (ca. 655 bases) (FASTA format) for each specimen that can be copied for use in other applications. For some Shrimp species, there is also a reverse 3' barcode (ca. 475 bases). In addition there are photographs or links to photographs for some of the specimens.

Sample ID: FDA 37
Common Name: Sheepshead
FDA Market Name(s): Sheepshead
Voucher Source: NMNH
Voucher Number: 394053
Metadata: (sub-sample 3)
Authenicated: yes; vouchered: yes
Single Lab validation study
CO1 DNA Sequence (barcode, FASTA format)
Additional information: NMNH ID 394053, BoLD ID SLV089-10, Genbank ID HQ024930
5' Barcode (~655 bp):
>FDA 3-37|Archosargus probatocephalus|SLV089-10|HQ024930
CCTTTACCTTGTATTTGGTGCTTGGGCCGGAATAGTAGGAACTGCCCTAAGCCTGCTCATCGAGCGGAACTAAGCCAGCCCGGCGCTCTCCTAGGAGACGACCAGATTTATAATGTAATTGTTACAGCACATGCATTTGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGAGGCTTTGGAAACTGATTAATTCCATTAATGATCGGAGCCCCTGACATAGCATTTCCCCGAATGAACAACATGAGCTTCTGACTGCTTCCCCCATCATTCCTCTTACTACTCGCCTCCTCCGGAGTCGAAGCTGGGGCCGGCACTGGGTGAACTGTTTACCCTCCGCTAGCAGGAAACCTCGCACATGCGGGTGCATCAGTTGACCTAACCATTTTCTCCCTTCACTTGGCTGGAGTTTCATCTATTCTTGGTGCCATTAATTTTATTACCACTATTATTAACATGAAACCTCCTGCCATTTCACAATATCAAACACCGCTATTTGTATGAGCTGTCCTAATCACCGCTGTCCTGCTTCTCCTATCCCTTCCAGTTCTCGCTGCCGGGATCACAATGCTTCTTACAGATCGAAACCTAAACACCACCTTCTTCGACCCTGCCGGAGGAGGGGACCCAATTCTCTATCAACATCTATTC

679662  

-
-