• Decrease font size
  • Return font size to normal
  • Increase font size
U.S. Department of Health and Human Services

Reference Standard Sequence Library (RSSL) for Seafood Identification

  • Print
  • Share
  • E-mail
-

Additional Information for   Anarhichas lupus

This detail page provides additional information about the selected specimen as well as a 5' barcode (ca. 655 bases) (FASTA format) for each specimen that can be copied for use in other applications. For some Shrimp species, there is also a reverse 3' barcode (ca. 475 bases). In addition there are photographs or links to photographs for some of the specimens.

Sample ID: RFE 351
Common Name: Atlantic Wolffish
FDA Market Name(s): Wolffish
Metadata: Authenticated: yes; vouchered: no
FDA Regulatory Fish Encyclopedia (RFE)
CO1 DNA Sequence (barcode, FASTA format)
Sequence updated: 11/2013
5' Barcode (~655 bp):
>RFE351_Anarhichas_lupus
CCTTTATCTAGTATTTGGTGCATGAGCCGGAATGGTAGGCACAGCCCTAAGCCTCCTCATTCGAGCGGAGCTAAGCCAACCCGGCGCCCTCTTGGGGGACGACCAAATTTATAATGTGATTGTTACGGCACATGCGTTCGTAATAATTTTCTTTATAGTGATACCAATTATAATTGGGGGTTTCGGAAACTGGCTTGTCCCCCTAATGATTGGGGCCCCGGACATAGCATTTCCCCGGATAAACAACATGAGCTTTTGACTTCTACCCCCATCTTTTCTCCTTCTCCTTGCCTCTTCCGGGGTAGAGGCTGGAGCTGGGACAGGGTGAACAGTTTATCCCCCGCTCTCGGGTAACTTAGCCCATGCAGGAGCCTCTGTTGATTTGACAATCTTTTCCCTTCACCTAGCAGGAATTTCTTCAATCCTTGGGGCAATTAATTTCATTACAACCATTATTAACATGAAACCCCCAGCGATTTCTCAGTACCAAACACCCCTCTTCGTTTGATCAGTGCTTATTACGGCCGTCCTGCTTCTCCTTTCCCTCCCCGTACTTGCAGCTGGTATTACCATACTCCTAACAGACCGTAACCTTAACACCACCTTCTTCGACCCCGCCGGAGGGGGGGACCCAATCCTTTATCAACACT

679661  

-
-