• Decrease font size
  • Return font size to normal
  • Increase font size
U.S. Department of Health and Human Services

Reference Standard Sequence Library (RSSL) for Seafood Identification

  • Print
  • Share
  • E-mail
-

Additional Information for   Acanthurus lineatus

This detail page provides additional information about the selected specimen as well as a 5' barcode (ca. 655 bases) (FASTA format) for each specimen that can be copied for use in other applications. For some Shrimp species, there is also a reverse 3' barcode (ca. 475 bases). In addition there are photographs or links to photographs for some of the specimens.

Sample ID: RP008
Common Name: Lined Surgeonfish
FDA Market Name(s): n/a
Voucher Source: NMNH
Voucher Number: 408808
Metadata: Smithsonian/Philippines market survey sample, 05/2012
5' Barcode (~655 bp):
>RP008_Acanthurus_lineatus
CCTTTATTTAGTATTTGGTGCTTGAGCTGGAATGGTAGGAACAGCTTTAAGCCTCCTAATCCGAGCAGAATTAAGTCAACCAGGCGCCCTTCTAGGGGATGACCAAATTTATAATGTAATTGTTACAGCACATGCATTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGTGGGTTTGGAAATTGACTAATCCCATTAATGATTGGAGCCCCCGACATAGCATTCCCACGAATGAATAATATAAGCTTTTGACTTCTACCACCATCCTTCCTGCTACTGCTTGCATCCTCTGCAGTAGAGTCAGGTGCTGGAACAGGATGAACAGTCTACCCCCCTCTGGCTGGCAATCTAGCACATGCAGGAGCATCTGTAGATCTTACTATTTTCTCCCTACACCTTGCAGGTATCTCTTCAATTCTTGGGGCTATTAACTTTATTACAACAATTATCAACATAAAACCCCCCGCTATCTCTCAATATCAGACCCCTCTATTTGTCTGAGCAGTATTAATTACTGCTGTCCTACTCCTCCTCTCACTTCCTGTCCTTGCTGCGGGTATTACAATGCTTCTTACAGATCGAAACTTAAATACTACCTTCTTCGATCCGGCAGGCGGAGGAGACCCCATTTTATATCAGCACTTATTC

679662  

-
-