• Decrease font size
  • Return font size to normal
  • Increase font size
U.S. Department of Health and Human Services

Reference Standard Sequence Library (RSSL) for Seafood Identification

  • Print
  • Share
  • E-mail
-

Additional Information for   Callinectes toxotes

This detail page provides additional information about the selected specimen as well as a 5' barcode (ca. 655 bases) (FASTA format) for each specimen that can be copied for use in other applications. For some Shrimp species, there is also a reverse 3' barcode (ca. 475 bases). In addition there are photographs or links to photographs for some of the specimens.

Sample ID: ULLZ11251
Common Name: Giant Swimcrab
FDA Market Name(s): Crab, Swimming 
Voucher Source: ULL
Voucher Number: ULLZ11251
Metadata: Authenticated: yes; vouchered: yes
University of Louisiana at Lafayette (ULL)
CO1 DNA Sequence (barcode, FASTA format)
5' Barcode (~655 bp):
>ULLZ11251_Callinectes_toxotes
ATTATATTTTATCTTTGGAGCATGATCTGGTATAGTTGGTACATCACTTAGTTTAATCATTCGAGCTGAACTAGGACAACCTGGAACCCTTATTGGAAATGATCAAATTTATAATGTTGTAGTTACAGCTCATGCTTTCGTTATAATTTTCTTCATAGTTATACCAATTATAATTGGAGGATTCGGTAACTGACTAGTCCCCCTTATGTTAGGAGCTCCAGATATAGCCTTTCCACGAATAAATAACATAAGATTCTGACTGCTTCCTCCATCTCTAACTTTACTATTAATAAGAGGTATAGTAGAAAGTGGAGTTGGTACAGGATGAACTGTCTATCCTCCTTTAGCCGCCGCTATCGCCCACGCAGGAGCCTCAGTTGACCTTGGTATTTTCTCTCTCCATTTAGCCGGTGTTTCGTCAATTCTAGGAGCAGTTAACTTTATAACCACCGTCATTAATATACGATCCTTCGGTATAAGAATAGACCAAATACCTTTATTCGTATGATCTGTATTTATTACCGCCATCCTACTTCTCCTTTCTTTACCCGTATTAGCAGGAGCCATTACTATACTACTTACTGACCGAAACCTGAATACTTCGTTCTTTGACCCAGCTGGCGGAGGGGACCCTGTTCTTTACCAACACTTATTT

679661  

-
-