• Decrease font size
  • Return font size to normal
  • Increase font size
U.S. Department of Health and Human Services

Search Orphan Drug Designations and Approvals

  • Print
  • Share
  • E-mail
-
Generic Name: PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'
Date Designated: 11/24/2014
Orphan Designation: Treatment of rabies virus infections
Orphan Designation Status: Designated
FDA Orphan Approval Status: Not FDA Approved for Orphan Indication
Mid-Atlantic BioTherapeutics, Inc.
3805 Old Easton Rd.
Doylestown, Pennsylvania 18902
United States

The sponsor address listed is the last reported by the sponsor to OOPD.

*Exclusivity Protected Indications are shown for approvals from 01/01/2013 to the present.
*Data for the Date Designation Withdrawn or Revoked field are shown for designations withdrawn or revoked after 08/12/2013.
-
-